Ifremer, UAR LEEISA (CNRS, Université de Guyane, Ifremer)

This study focuses on 8 sampling sites located in fishing grounds of F. Guiana, Suriname and Trinidad and Tobago waters. For each site between 16 and 30 shrimps were collected depending on the catch of one trawl in the area. Three mitochondrial genes were selected following previous studies based on this species (Baldwin et al., 1998; Gusmão et al., 2000; Timm et al., 2019). Primers CO9 (5’-TCGGTCA(T/C)CCAGAAGT(C/A)TAT) and CO10 (5’-AAGCGTCTGGGTAGTCTGA(A/G)TA(T/G)CG) and the two ribosomal structural genes, 12S (12Sf : 5’ -GAAACCAGGATTAGATACCC; 12SR : 5’ -AGCGACGGGCGATATGTAC) and 16S (16SarL : 5’-CGCCTGTTTATCAAAAACAT; 16SbrH : 5’ – CGGGTCTGAACTCAGATCACGT) were selected. PCR amplification was conducted in thermocycler. Samples with CO9-10 primers were submitted to denaturation for 5m min at 95°C followed by 35 cycles of 1 min at 95°, 1 min at 47°C and 1 min at 72°C with a final extension of 5 min at 72°C. The PCR of 12S primers had a denaturation step of 5m min at 95°C followed by 30 cycles of 45 sec at 95°, 1 min at 58°C and 1 min at 72°C with a final extension of 5 min at 72°C. The PCR of 16S primers had a denaturation step of 5m min at 95°C followed by 30 cycles of 45 sec at 95°, 1 min at 50°C and 1 min at 72°C with a final extension of 5 min at 72°C.